SubtiBank SubtiBank
Version comparison:

2020-03-19 16:33:382025-04-11 15:29:47

The protein

[SW|Domains]

N-terminal ppGpp hydrolase domain ([SW|HD domain]) (aa 31-180) [Pubmed|24163341]

central ppGpp synthetase domain [Pubmed|24163341]

[SW|TGS domain] (aa 392-453) (according to UniProt)

C-terminal [SW|ACT domain] (aa 660-734) (according to UniProt)

N-terminal ppGpp hydrolase domain ([SW|HD domain]) (aa 31-180) [Pubmed|24163341]

central ppGpp synthetase domain [Pubmed|24163341]

[SW|TGS domain] (aa 392-453) (according to UniProt)

C-terminal [SW|ACT domain] (aa 660-734) (responsible for fine-tuning of activation at the ribosome) [pubmed|32184768]

The protein

Effectors of protein activity

(p)ppGpp synthesis is activated by uncharged tRNAs in a ribosome-dependent manner

the interaction with [[protein|ComGA]] inhibits the hydrolysis of ppGpp [Pubmed|25899641]

heat stress triggers (p)ppGpp synthesis [pubmed|32176689]

(p)ppGpp synthesis is activated by uncharged tRNAs in a ribosome-dependent manner

the interaction with [[protein|ComGA]] inhibits the hydrolysis of ppGpp [Pubmed|25899641]

heat stress triggers (p)ppGpp synthesis [pubmed|32176689]

the presence of immature tRNAs due to depletion of [[protein|RnpA|RNase P]] or [[protein|Rnz|RNase Z]] triggers (p)ppGpp synthesis by [[protein|RelA]] [pubmed|31003868]

The protein

Structure

[PDB|5IQR] (from E. coli, bound to the [SW|ribosome], 38.8% identity)

[PDB|1VJ7] (N-terminal catalytic fragment, from ''Streptococcus equisimilis'', 60% identity) [Pubmed|15066282]

[PDB|6YXA] (aa 1 ... 556) [pubmed|32937119]

[PDB|6HTQ] (the [[protein|RelA]]-[SW|ribosome] complex) [pubmed|32937119]

[PDB|1VJ7] (N-terminal catalytic fragment, from ''Streptococcus equisimilis'', 60% identity) [Pubmed|15066282]

Biological materials

Mutant

''[[gene|relA]]'' mutant [Pubmed|9383190] - note that ''[[gene|relA]]'' mutants are prone to suppressor mutations in the ''[[gene|sasA]]'' or ''[[gene|sasB]]'' loci [Pubmed|18670626]

GP2066 (''[[gene|sasA]] [[gene|sasB]] [[gene|relA]]::mls''), available in [SW|Jörg Stülke]'s lab

BKE27600 (Δ[[gene|relA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA

BKK27600 (Δ[[gene|relA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA

GP3429 ''relA-6xHis-cat'', available in Jörg Stülke's lab

''[[gene|relA]]'' mutant [Pubmed|9383190] - note that ''[[gene|relA]]'' mutants are prone to suppressor mutations in the ''[[gene|sasA]]'' or ''[[gene|sasB]]'' loci [Pubmed|18670626]

GP2066 (''[[gene|sasA]] [[gene|sasB]] [[gene|relA]]::mls''), available in [SW|Jörg Stülke]'s lab

BKE27600 (Δ[[gene|relA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA

BKK27600 (Δ[[gene|relA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA

labs

[SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]

Jue D Wang, University of Wisconsin–Madison [https://www.researchgate.net/profile/Jue_Wang8 ResearchGate-Profile]

[SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]

[SW|Jade Wang], University of Wisconsin–Madison [https://bact.wisc.edu/people_profile.php?t=rf&p=jdwang2 homepage]

References

Original publications

25331430, 9383190, 10209741, 24489751, 19447912, 13129942, 12372825, 12081964, 11948165, 12419222, 23028324, 24163341, 24682323, 25899641, 15066282, 27775002, 27875634, 31003868, 15066282, 32176689

25331430, 9383190, 10209741, 24489751, 19447912, 13129942, 12372825, 12081964, 11948165, 12419222, 23028324, 24163341, 24682323, 25899641, 15066282, 27775002, 27875634, 31003868, 15066282, 32176689, 32184768, 31003868, 32393900, 32937119