2020-03-19 16:33:382025-04-11 15:29:47
The protein
[SW|Domains]
N-terminal ppGpp hydrolase domain ([SW|HD domain]) (aa 31-180) [Pubmed|24163341]
central ppGpp synthetase domain [Pubmed|24163341]
[SW|TGS domain] (aa 392-453) (according to UniProt)
C-terminal [SW|ACT domain] (aa 660-734) (according to UniProt)
N-terminal ppGpp hydrolase domain ([SW|HD domain]) (aa 31-180) [Pubmed|24163341]
central ppGpp synthetase domain [Pubmed|24163341]
[SW|TGS domain] (aa 392-453) (according to UniProt)
C-terminal [SW|ACT domain] (aa 660-734) (responsible for fine-tuning of activation at the ribosome) [pubmed|32184768]
The protein
Effectors of protein activity
(p)ppGpp synthesis is activated by uncharged tRNAs in a ribosome-dependent manner
the interaction with [[protein|ComGA]] inhibits the hydrolysis of ppGpp [Pubmed|25899641]
heat stress triggers (p)ppGpp synthesis [pubmed|32176689]
(p)ppGpp synthesis is activated by uncharged tRNAs in a ribosome-dependent manner
the interaction with [[protein|ComGA]] inhibits the hydrolysis of ppGpp [Pubmed|25899641]
heat stress triggers (p)ppGpp synthesis [pubmed|32176689]
the presence of immature tRNAs due to depletion of [[protein|RnpA|RNase P]] or [[protein|Rnz|RNase Z]] triggers (p)ppGpp synthesis by [[protein|RelA]] [pubmed|31003868]
The protein
Structure
[PDB|5IQR] (from E. coli, bound to the [SW|ribosome], 38.8% identity)
[PDB|1VJ7] (N-terminal catalytic fragment, from ''Streptococcus equisimilis'', 60% identity) [Pubmed|15066282]
[PDB|6YXA] (aa 1 ... 556) [pubmed|32937119]
[PDB|6HTQ] (the [[protein|RelA]]-[SW|ribosome] complex) [pubmed|32937119]
[PDB|1VJ7] (N-terminal catalytic fragment, from ''Streptococcus equisimilis'', 60% identity) [Pubmed|15066282]
Biological materials
Mutant
''[[gene|relA]]'' mutant [Pubmed|9383190] - note that ''[[gene|relA]]'' mutants are prone to suppressor mutations in the ''[[gene|sasA]]'' or ''[[gene|sasB]]'' loci [Pubmed|18670626]
GP2066 (''[[gene|sasA]] [[gene|sasB]] [[gene|relA]]::mls''), available in [SW|Jörg Stülke]'s lab
BKE27600 (Δ[[gene|relA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA
BKK27600 (Δ[[gene|relA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA
GP3429 ''relA-6xHis-cat'', available in Jörg Stülke's lab
''[[gene|relA]]'' mutant [Pubmed|9383190] - note that ''[[gene|relA]]'' mutants are prone to suppressor mutations in the ''[[gene|sasA]]'' or ''[[gene|sasB]]'' loci [Pubmed|18670626]
GP2066 (''[[gene|sasA]] [[gene|sasB]] [[gene|relA]]::mls''), available in [SW|Jörg Stülke]'s lab
BKE27600 (Δ[[gene|relA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA
BKK27600 (Δ[[gene|relA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGAATCACCTTTTTTAA, downstream forward: _UP4_TAAAGGGGTTAGAAAAGAGA
labs
[SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
Jue D Wang, University of Wisconsin–Madison [https://www.researchgate.net/profile/Jue_Wang8 ResearchGate-Profile]
[SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
[SW|Jade Wang], University of Wisconsin–Madison [https://bact.wisc.edu/people_profile.php?t=rf&p=jdwang2 homepage]
References
Original publications